ID: 1176579562

View in Genome Browser
Species Human (GRCh38)
Location 21:8463115-8463137
Sequence ACGTGGGTAGTGGGGGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176579562_1176579574 8 Left 1176579562 21:8463115-8463137 CCGGCTCCCCCCACTACCCACGT No data
Right 1176579574 21:8463146-8463168 CTTAATTTAGTGAGTCGGTTAGG No data
1176579562_1176579572 3 Left 1176579562 21:8463115-8463137 CCGGCTCCCCCCACTACCCACGT No data
Right 1176579572 21:8463141-8463163 TTCACCTTAATTTAGTGAGTCGG No data
1176579562_1176579575 11 Left 1176579562 21:8463115-8463137 CCGGCTCCCCCCACTACCCACGT No data
Right 1176579575 21:8463149-8463171 AATTTAGTGAGTCGGTTAGGTGG No data
1176579562_1176579576 12 Left 1176579562 21:8463115-8463137 CCGGCTCCCCCCACTACCCACGT No data
Right 1176579576 21:8463150-8463172 ATTTAGTGAGTCGGTTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176579562 Original CRISPR ACGTGGGTAGTGGGGGGAGC CGG (reversed) Intergenic
No off target data available for this crispr