ID: 1176579873

View in Genome Browser
Species Human (GRCh38)
Location 21:8465995-8466017
Sequence GATACCTCTGCATTGGCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176579865_1176579873 11 Left 1176579865 21:8465961-8465983 CCGCAAAGCTGACCTGTCCCACC No data
Right 1176579873 21:8465995-8466017 GATACCTCTGCATTGGCCCGAGG No data
1176579871_1176579873 -10 Left 1176579871 21:8465982-8466004 CCGAGGTCAAATGGATACCTCTG No data
Right 1176579873 21:8465995-8466017 GATACCTCTGCATTGGCCCGAGG No data
1176579869_1176579873 -6 Left 1176579869 21:8465978-8466000 CCCACCGAGGTCAAATGGATACC No data
Right 1176579873 21:8465995-8466017 GATACCTCTGCATTGGCCCGAGG No data
1176579867_1176579873 -1 Left 1176579867 21:8465973-8465995 CCTGTCCCACCGAGGTCAAATGG No data
Right 1176579873 21:8465995-8466017 GATACCTCTGCATTGGCCCGAGG No data
1176579870_1176579873 -7 Left 1176579870 21:8465979-8466001 CCACCGAGGTCAAATGGATACCT No data
Right 1176579873 21:8465995-8466017 GATACCTCTGCATTGGCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176579873 Original CRISPR GATACCTCTGCATTGGCCCG AGG Intergenic
No off target data available for this crispr