ID: 1176580026

View in Genome Browser
Species Human (GRCh38)
Location 21:8466585-8466607
Sequence AATCTATTTTGTGGCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176580026_1176580034 6 Left 1176580026 21:8466585-8466607 CCCTTGAGGCCACAAAATAGATT No data
Right 1176580034 21:8466614-8466636 CACCCATCGACGTTTCCCCCGGG No data
1176580026_1176580037 12 Left 1176580026 21:8466585-8466607 CCCTTGAGGCCACAAAATAGATT No data
Right 1176580037 21:8466620-8466642 TCGACGTTTCCCCCGGGTGCTGG No data
1176580026_1176580033 5 Left 1176580026 21:8466585-8466607 CCCTTGAGGCCACAAAATAGATT No data
Right 1176580033 21:8466613-8466635 CCACCCATCGACGTTTCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176580026 Original CRISPR AATCTATTTTGTGGCCTCAA GGG (reversed) Intergenic
No off target data available for this crispr