ID: 1176580038

View in Genome Browser
Species Human (GRCh38)
Location 21:8466629-8466651
Sequence AGGATACATCCAGCACCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176580038_1176580046 24 Left 1176580038 21:8466629-8466651 CCCCCGGGTGCTGGATGTATCCT No data
Right 1176580046 21:8466676-8466698 GTCGAATTAAACACCTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176580038 Original CRISPR AGGATACATCCAGCACCCGG GGG (reversed) Intergenic
No off target data available for this crispr