ID: 1176580046

View in Genome Browser
Species Human (GRCh38)
Location 21:8466676-8466698
Sequence GTCGAATTAAACACCTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176580039_1176580046 23 Left 1176580039 21:8466630-8466652 CCCCGGGTGCTGGATGTATCCTG No data
Right 1176580046 21:8466676-8466698 GTCGAATTAAACACCTTGACTGG No data
1176580038_1176580046 24 Left 1176580038 21:8466629-8466651 CCCCCGGGTGCTGGATGTATCCT No data
Right 1176580046 21:8466676-8466698 GTCGAATTAAACACCTTGACTGG No data
1176580041_1176580046 21 Left 1176580041 21:8466632-8466654 CCGGGTGCTGGATGTATCCTGTC No data
Right 1176580046 21:8466676-8466698 GTCGAATTAAACACCTTGACTGG No data
1176580043_1176580046 -8 Left 1176580043 21:8466661-8466683 CCTGAGCCTGACACCGTCGAATT No data
Right 1176580046 21:8466676-8466698 GTCGAATTAAACACCTTGACTGG No data
1176580042_1176580046 4 Left 1176580042 21:8466649-8466671 CCTGTCAAGAGACCTGAGCCTGA No data
Right 1176580046 21:8466676-8466698 GTCGAATTAAACACCTTGACTGG No data
1176580040_1176580046 22 Left 1176580040 21:8466631-8466653 CCCGGGTGCTGGATGTATCCTGT No data
Right 1176580046 21:8466676-8466698 GTCGAATTAAACACCTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176580046 Original CRISPR GTCGAATTAAACACCTTGAC TGG Intergenic
No off target data available for this crispr