ID: 1176580330

View in Genome Browser
Species Human (GRCh38)
Location 21:8469649-8469671
Sequence CTTTTTTGAAGGGGCTCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176580325_1176580330 -6 Left 1176580325 21:8469632-8469654 CCGATTCTGGCAACAGGCTTTTT No data
Right 1176580330 21:8469649-8469671 CTTTTTTGAAGGGGCTCCGGTGG No data
1176580319_1176580330 28 Left 1176580319 21:8469598-8469620 CCTCTGCGAGAAGACAGACGGTG No data
Right 1176580330 21:8469649-8469671 CTTTTTTGAAGGGGCTCCGGTGG No data
1176580323_1176580330 3 Left 1176580323 21:8469623-8469645 CCGGTTTGGCCGATTCTGGCAAC No data
Right 1176580330 21:8469649-8469671 CTTTTTTGAAGGGGCTCCGGTGG No data
1176580318_1176580330 29 Left 1176580318 21:8469597-8469619 CCCTCTGCGAGAAGACAGACGGT No data
Right 1176580330 21:8469649-8469671 CTTTTTTGAAGGGGCTCCGGTGG No data
1176580316_1176580330 30 Left 1176580316 21:8469596-8469618 CCCCTCTGCGAGAAGACAGACGG No data
Right 1176580330 21:8469649-8469671 CTTTTTTGAAGGGGCTCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176580330 Original CRISPR CTTTTTTGAAGGGGCTCCGG TGG Intergenic
No off target data available for this crispr