ID: 1176581210

View in Genome Browser
Species Human (GRCh38)
Location 21:8528880-8528902
Sequence GGCCCAGCTGTGTCTCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176581210_1176581211 -8 Left 1176581210 21:8528880-8528902 CCTGCTTGAGACACAGCTGGGCC No data
Right 1176581211 21:8528895-8528917 GCTGGGCCTTGAGCTTTTAAAGG No data
1176581210_1176581213 11 Left 1176581210 21:8528880-8528902 CCTGCTTGAGACACAGCTGGGCC No data
Right 1176581213 21:8528914-8528936 AAGGTGCTATAACTTTACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176581210 Original CRISPR GGCCCAGCTGTGTCTCAAGC AGG (reversed) Intergenic
No off target data available for this crispr