ID: 1176583438

View in Genome Browser
Species Human (GRCh38)
Location 21:8550968-8550990
Sequence AAGGATCCAGGGTCCTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176583424_1176583438 23 Left 1176583424 21:8550922-8550944 CCTTGAGCGCGATTTGTGGGGCG No data
Right 1176583438 21:8550968-8550990 AAGGATCCAGGGTCCTGTGGGGG No data
1176583420_1176583438 28 Left 1176583420 21:8550917-8550939 CCTCACCTTGAGCGCGATTTGTG No data
Right 1176583438 21:8550968-8550990 AAGGATCCAGGGTCCTGTGGGGG No data
1176583419_1176583438 29 Left 1176583419 21:8550916-8550938 CCCTCACCTTGAGCGCGATTTGT No data
Right 1176583438 21:8550968-8550990 AAGGATCCAGGGTCCTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176583438 Original CRISPR AAGGATCCAGGGTCCTGTGG GGG Intergenic