ID: 1176589082

View in Genome Browser
Species Human (GRCh38)
Location 21:8623087-8623109
Sequence AATAAAATGATGAAACCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176589081_1176589082 -9 Left 1176589081 21:8623073-8623095 CCTTGATGTCTCAGAATAAAATG No data
Right 1176589082 21:8623087-8623109 AATAAAATGATGAAACCAGAAGG No data
1176589080_1176589082 -8 Left 1176589080 21:8623072-8623094 CCCTTGATGTCTCAGAATAAAAT No data
Right 1176589082 21:8623087-8623109 AATAAAATGATGAAACCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176589082 Original CRISPR AATAAAATGATGAAACCAGA AGG Intergenic
No off target data available for this crispr