ID: 1176591633

View in Genome Browser
Species Human (GRCh38)
Location 21:8654902-8654924
Sequence CCTGGCACGGAGCAGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176591633_1176591641 13 Left 1176591633 21:8654902-8654924 CCACCCAGCTGCTCCGTGCCAGG No data
Right 1176591641 21:8654938-8654960 ACCTAGAGCCTGCAACACCACGG No data
1176591633_1176591644 29 Left 1176591633 21:8654902-8654924 CCACCCAGCTGCTCCGTGCCAGG No data
Right 1176591644 21:8654954-8654976 ACCACGGCTCGCCTCGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176591633 Original CRISPR CCTGGCACGGAGCAGCTGGG TGG (reversed) Intergenic
No off target data available for this crispr