ID: 1176592758

View in Genome Browser
Species Human (GRCh38)
Location 21:8659334-8659356
Sequence CTCTGGCCCTGCCTTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176592758_1176592766 24 Left 1176592758 21:8659334-8659356 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1176592766 21:8659381-8659403 GATTTGCCCTGCCCCAACGTTGG No data
1176592758_1176592762 -10 Left 1176592758 21:8659334-8659356 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1176592762 21:8659347-8659369 AGGGCCAGAGCTGGAATTGGAGG No data
1176592758_1176592764 -2 Left 1176592758 21:8659334-8659356 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1176592764 21:8659355-8659377 AGCTGGAATTGGAGGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176592758 Original CRISPR CTCTGGCCCTGCCTTGGCCC TGG (reversed) Intergenic
No off target data available for this crispr