ID: 1176592760

View in Genome Browser
Species Human (GRCh38)
Location 21:8659340-8659362
Sequence TTCCAGCTCTGGCCCTGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176592760_1176592766 18 Left 1176592760 21:8659340-8659362 CCAAGGCAGGGCCAGAGCTGGAA No data
Right 1176592766 21:8659381-8659403 GATTTGCCCTGCCCCAACGTTGG No data
1176592760_1176592764 -8 Left 1176592760 21:8659340-8659362 CCAAGGCAGGGCCAGAGCTGGAA No data
Right 1176592764 21:8659355-8659377 AGCTGGAATTGGAGGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176592760 Original CRISPR TTCCAGCTCTGGCCCTGCCT TGG (reversed) Intergenic
No off target data available for this crispr