ID: 1176592762

View in Genome Browser
Species Human (GRCh38)
Location 21:8659347-8659369
Sequence AGGGCCAGAGCTGGAATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176592748_1176592762 18 Left 1176592748 21:8659306-8659328 CCAGGGACAAGGTCAGGCCAGGA No data
Right 1176592762 21:8659347-8659369 AGGGCCAGAGCTGGAATTGGAGG No data
1176592754_1176592762 1 Left 1176592754 21:8659323-8659345 CCAGGAAGGGGCCAGGGCCAAGG No data
Right 1176592762 21:8659347-8659369 AGGGCCAGAGCTGGAATTGGAGG No data
1176592758_1176592762 -10 Left 1176592758 21:8659334-8659356 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1176592762 21:8659347-8659369 AGGGCCAGAGCTGGAATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176592762 Original CRISPR AGGGCCAGAGCTGGAATTGG AGG Intergenic
No off target data available for this crispr