ID: 1176592764

View in Genome Browser
Species Human (GRCh38)
Location 21:8659355-8659377
Sequence AGCTGGAATTGGAGGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176592758_1176592764 -2 Left 1176592758 21:8659334-8659356 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1176592764 21:8659355-8659377 AGCTGGAATTGGAGGTGTCCTGG No data
1176592760_1176592764 -8 Left 1176592760 21:8659340-8659362 CCAAGGCAGGGCCAGAGCTGGAA No data
Right 1176592764 21:8659355-8659377 AGCTGGAATTGGAGGTGTCCTGG No data
1176592748_1176592764 26 Left 1176592748 21:8659306-8659328 CCAGGGACAAGGTCAGGCCAGGA No data
Right 1176592764 21:8659355-8659377 AGCTGGAATTGGAGGTGTCCTGG No data
1176592754_1176592764 9 Left 1176592754 21:8659323-8659345 CCAGGAAGGGGCCAGGGCCAAGG No data
Right 1176592764 21:8659355-8659377 AGCTGGAATTGGAGGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176592764 Original CRISPR AGCTGGAATTGGAGGTGTCC TGG Intergenic
No off target data available for this crispr