ID: 1176592766

View in Genome Browser
Species Human (GRCh38)
Location 21:8659381-8659403
Sequence GATTTGCCCTGCCCCAACGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176592760_1176592766 18 Left 1176592760 21:8659340-8659362 CCAAGGCAGGGCCAGAGCTGGAA No data
Right 1176592766 21:8659381-8659403 GATTTGCCCTGCCCCAACGTTGG No data
1176592763_1176592766 7 Left 1176592763 21:8659351-8659373 CCAGAGCTGGAATTGGAGGTGTC No data
Right 1176592766 21:8659381-8659403 GATTTGCCCTGCCCCAACGTTGG No data
1176592758_1176592766 24 Left 1176592758 21:8659334-8659356 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1176592766 21:8659381-8659403 GATTTGCCCTGCCCCAACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176592766 Original CRISPR GATTTGCCCTGCCCCAACGT TGG Intergenic
No off target data available for this crispr