ID: 1176596838

View in Genome Browser
Species Human (GRCh38)
Location 21:8705511-8705533
Sequence CCTTTCTAGGACATCCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176596838_1176596845 11 Left 1176596838 21:8705511-8705533 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1176596845 21:8705545-8705567 TTCAGCTGTCCACTTTTGGGCGG No data
1176596838_1176596844 8 Left 1176596838 21:8705511-8705533 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1176596844 21:8705542-8705564 TGCTTCAGCTGTCCACTTTTGGG No data
1176596838_1176596843 7 Left 1176596838 21:8705511-8705533 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1176596843 21:8705541-8705563 GTGCTTCAGCTGTCCACTTTTGG No data
1176596838_1176596847 27 Left 1176596838 21:8705511-8705533 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1176596847 21:8705561-8705583 TGGGCGGTACCTGCCTATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176596838 Original CRISPR CCTTTCTAGGACATCCCTGA AGG (reversed) Intergenic