ID: 1176596842

View in Genome Browser
Species Human (GRCh38)
Location 21:8705524-8705546
Sequence AAGCACTACAGCCCCTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176596842_1176596844 -5 Left 1176596842 21:8705524-8705546 CCTAGAAAGGGGCTGTAGTGCTT No data
Right 1176596844 21:8705542-8705564 TGCTTCAGCTGTCCACTTTTGGG No data
1176596842_1176596847 14 Left 1176596842 21:8705524-8705546 CCTAGAAAGGGGCTGTAGTGCTT No data
Right 1176596847 21:8705561-8705583 TGGGCGGTACCTGCCTATTGTGG No data
1176596842_1176596843 -6 Left 1176596842 21:8705524-8705546 CCTAGAAAGGGGCTGTAGTGCTT No data
Right 1176596843 21:8705541-8705563 GTGCTTCAGCTGTCCACTTTTGG No data
1176596842_1176596845 -2 Left 1176596842 21:8705524-8705546 CCTAGAAAGGGGCTGTAGTGCTT No data
Right 1176596845 21:8705545-8705567 TTCAGCTGTCCACTTTTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176596842 Original CRISPR AAGCACTACAGCCCCTTTCT AGG (reversed) Intergenic