ID: 1176596844

View in Genome Browser
Species Human (GRCh38)
Location 21:8705542-8705564
Sequence TGCTTCAGCTGTCCACTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176596838_1176596844 8 Left 1176596838 21:8705511-8705533 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1176596844 21:8705542-8705564 TGCTTCAGCTGTCCACTTTTGGG No data
1176596842_1176596844 -5 Left 1176596842 21:8705524-8705546 CCTAGAAAGGGGCTGTAGTGCTT No data
Right 1176596844 21:8705542-8705564 TGCTTCAGCTGTCCACTTTTGGG No data
1176596836_1176596844 21 Left 1176596836 21:8705498-8705520 CCTTCACCACTCTCCTTCAGGGA No data
Right 1176596844 21:8705542-8705564 TGCTTCAGCTGTCCACTTTTGGG No data
1176596837_1176596844 15 Left 1176596837 21:8705504-8705526 CCACTCTCCTTCAGGGATGTCCT No data
Right 1176596844 21:8705542-8705564 TGCTTCAGCTGTCCACTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176596844 Original CRISPR TGCTTCAGCTGTCCACTTTT GGG Intergenic