ID: 1176596847

View in Genome Browser
Species Human (GRCh38)
Location 21:8705561-8705583
Sequence TGGGCGGTACCTGCCTATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176596842_1176596847 14 Left 1176596842 21:8705524-8705546 CCTAGAAAGGGGCTGTAGTGCTT No data
Right 1176596847 21:8705561-8705583 TGGGCGGTACCTGCCTATTGTGG No data
1176596838_1176596847 27 Left 1176596838 21:8705511-8705533 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1176596847 21:8705561-8705583 TGGGCGGTACCTGCCTATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176596847 Original CRISPR TGGGCGGTACCTGCCTATTG TGG Intergenic