ID: 1176596862

View in Genome Browser
Species Human (GRCh38)
Location 21:8705645-8705667
Sequence CCCCATGAGGTCATCAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176596853_1176596862 18 Left 1176596853 21:8705604-8705626 CCCTAGTCCTCCCTTCCTGTGTT No data
Right 1176596862 21:8705645-8705667 CCCCATGAGGTCATCAGTGCAGG No data
1176596852_1176596862 23 Left 1176596852 21:8705599-8705621 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1176596862 21:8705645-8705667 CCCCATGAGGTCATCAGTGCAGG No data
1176596855_1176596862 11 Left 1176596855 21:8705611-8705633 CCTCCCTTCCTGTGTTAACTGCT No data
Right 1176596862 21:8705645-8705667 CCCCATGAGGTCATCAGTGCAGG No data
1176596856_1176596862 8 Left 1176596856 21:8705614-8705636 CCCTTCCTGTGTTAACTGCTCAA No data
Right 1176596862 21:8705645-8705667 CCCCATGAGGTCATCAGTGCAGG No data
1176596859_1176596862 3 Left 1176596859 21:8705619-8705641 CCTGTGTTAACTGCTCAAAGGCA No data
Right 1176596862 21:8705645-8705667 CCCCATGAGGTCATCAGTGCAGG No data
1176596857_1176596862 7 Left 1176596857 21:8705615-8705637 CCTTCCTGTGTTAACTGCTCAAA No data
Right 1176596862 21:8705645-8705667 CCCCATGAGGTCATCAGTGCAGG No data
1176596854_1176596862 17 Left 1176596854 21:8705605-8705627 CCTAGTCCTCCCTTCCTGTGTTA No data
Right 1176596862 21:8705645-8705667 CCCCATGAGGTCATCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176596862 Original CRISPR CCCCATGAGGTCATCAGTGC AGG Intergenic
No off target data available for this crispr