ID: 1176597557

View in Genome Browser
Species Human (GRCh38)
Location 21:8761141-8761163
Sequence GAAAAAGAAAAACTTCCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176597557_1176597563 -9 Left 1176597557 21:8761141-8761163 CCACGGGGAAGTTTTTCTTTTTC No data
Right 1176597563 21:8761155-8761177 TTCTTTTTCAGGAGGGAGGAGGG No data
1176597557_1176597568 22 Left 1176597557 21:8761141-8761163 CCACGGGGAAGTTTTTCTTTTTC No data
Right 1176597568 21:8761186-8761208 GGTAATGTGTCTAGAGCATTGGG No data
1176597557_1176597567 21 Left 1176597557 21:8761141-8761163 CCACGGGGAAGTTTTTCTTTTTC No data
Right 1176597567 21:8761185-8761207 AGGTAATGTGTCTAGAGCATTGG No data
1176597557_1176597562 -10 Left 1176597557 21:8761141-8761163 CCACGGGGAAGTTTTTCTTTTTC No data
Right 1176597562 21:8761154-8761176 TTTCTTTTTCAGGAGGGAGGAGG No data
1176597557_1176597564 1 Left 1176597557 21:8761141-8761163 CCACGGGGAAGTTTTTCTTTTTC No data
Right 1176597564 21:8761165-8761187 GGAGGGAGGAGGGCTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176597557 Original CRISPR GAAAAAGAAAAACTTCCCCG TGG (reversed) Intergenic
No off target data available for this crispr