ID: 1176597568

View in Genome Browser
Species Human (GRCh38)
Location 21:8761186-8761208
Sequence GGTAATGTGTCTAGAGCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176597556_1176597568 23 Left 1176597556 21:8761140-8761162 CCCACGGGGAAGTTTTTCTTTTT No data
Right 1176597568 21:8761186-8761208 GGTAATGTGTCTAGAGCATTGGG No data
1176597557_1176597568 22 Left 1176597557 21:8761141-8761163 CCACGGGGAAGTTTTTCTTTTTC No data
Right 1176597568 21:8761186-8761208 GGTAATGTGTCTAGAGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176597568 Original CRISPR GGTAATGTGTCTAGAGCATT GGG Intergenic
No off target data available for this crispr