ID: 1176602449

View in Genome Browser
Species Human (GRCh38)
Location 21:8806115-8806137
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176602440_1176602449 5 Left 1176602440 21:8806087-8806109 CCTTGGGTCTGAGTTTCTGGGAG No data
Right 1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG No data
1176602439_1176602449 6 Left 1176602439 21:8806086-8806108 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG No data
1176602433_1176602449 29 Left 1176602433 21:8806063-8806085 CCACATCTCTGGTGAGGAGCTGC No data
Right 1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG No data
1176602437_1176602449 7 Left 1176602437 21:8806085-8806107 CCCCTTGGGTCTGAGTTTCTGGG No data
Right 1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176602449 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr