ID: 1176602928

View in Genome Browser
Species Human (GRCh38)
Location 21:8809384-8809406
Sequence AGGGAGAAGCTGGGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176602928_1176602940 7 Left 1176602928 21:8809384-8809406 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1176602940 21:8809414-8809436 CCCAGAAACTCAGACCCAAGGGG No data
1176602928_1176602937 5 Left 1176602928 21:8809384-8809406 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1176602937 21:8809412-8809434 CTCCCAGAAACTCAGACCCAAGG No data
1176602928_1176602944 29 Left 1176602928 21:8809384-8809406 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1176602944 21:8809436-8809458 GCAGCTCCTCACCAGAGATGTGG No data
1176602928_1176602938 6 Left 1176602928 21:8809384-8809406 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1176602938 21:8809413-8809435 TCCCAGAAACTCAGACCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176602928 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr