ID: 1176611338

View in Genome Browser
Species Human (GRCh38)
Location 21:8987818-8987840
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176611324_1176611338 11 Left 1176611324 21:8987784-8987806 CCCCGCCTCGCCGCCGCCCGCGG No data
Right 1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG No data
1176611323_1176611338 15 Left 1176611323 21:8987780-8987802 CCGTCCCCGCCTCGCCGCCGCCC No data
Right 1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG No data
1176611329_1176611338 6 Left 1176611329 21:8987789-8987811 CCTCGCCGCCGCCCGCGGGCGCC No data
Right 1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG No data
1176611328_1176611338 9 Left 1176611328 21:8987786-8987808 CCGCCTCGCCGCCGCCCGCGGGC No data
Right 1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG No data
1176611331_1176611338 1 Left 1176611331 21:8987794-8987816 CCGCCGCCCGCGGGCGCCGGCCG No data
Right 1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG No data
1176611334_1176611338 -6 Left 1176611334 21:8987801-8987823 CCGCGGGCGCCGGCCGCGCGCGC No data
Right 1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG No data
1176611326_1176611338 10 Left 1176611326 21:8987785-8987807 CCCGCCTCGCCGCCGCCCGCGGG No data
Right 1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG No data
1176611333_1176611338 -5 Left 1176611333 21:8987800-8987822 CCCGCGGGCGCCGGCCGCGCGCG No data
Right 1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG No data
1176611332_1176611338 -2 Left 1176611332 21:8987797-8987819 CCGCCCGCGGGCGCCGGCCGCGC No data
Right 1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176611338 Original CRISPR GCGCGCGCGCGCGTGGCCGC CGG Intergenic