ID: 1176611894

View in Genome Browser
Species Human (GRCh38)
Location 21:8991218-8991240
Sequence AGGGAGAAGCTGGCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176611894_1176611911 29 Left 1176611894 21:8991218-8991240 CCTGCCTCAGCCAGCTTCTCCCT No data
Right 1176611911 21:8991270-8991292 GCAGCTCCTCACCAGGGATGTGG No data
1176611894_1176611910 23 Left 1176611894 21:8991218-8991240 CCTGCCTCAGCCAGCTTCTCCCT No data
Right 1176611910 21:8991264-8991286 CAAGGGGCAGCTCCTCACCAGGG No data
1176611894_1176611909 22 Left 1176611894 21:8991218-8991240 CCTGCCTCAGCCAGCTTCTCCCT No data
Right 1176611909 21:8991263-8991285 CCAAGGGGCAGCTCCTCACCAGG No data
1176611894_1176611902 5 Left 1176611894 21:8991218-8991240 CCTGCCTCAGCCAGCTTCTCCCT No data
Right 1176611902 21:8991246-8991268 CTCCCAGAAACTCATACCCAAGG No data
1176611894_1176611905 7 Left 1176611894 21:8991218-8991240 CCTGCCTCAGCCAGCTTCTCCCT No data
Right 1176611905 21:8991248-8991270 CCCAGAAACTCATACCCAAGGGG No data
1176611894_1176611903 6 Left 1176611894 21:8991218-8991240 CCTGCCTCAGCCAGCTTCTCCCT No data
Right 1176611903 21:8991247-8991269 TCCCAGAAACTCATACCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176611894 Original CRISPR AGGGAGAAGCTGGCTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr