ID: 1176619599

View in Genome Browser
Species Human (GRCh38)
Location 21:9047009-9047031
Sequence CAGCAGAGGAAGACCGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176619587_1176619599 19 Left 1176619587 21:9046967-9046989 CCCCTGTGACTGAATAGTGGCCA No data
Right 1176619599 21:9047009-9047031 CAGCAGAGGAAGACCGGGGTAGG No data
1176619592_1176619599 -6 Left 1176619592 21:9046992-9047014 CCAGCTGCTCCAGGCTCCAGCAG No data
Right 1176619599 21:9047009-9047031 CAGCAGAGGAAGACCGGGGTAGG No data
1176619588_1176619599 18 Left 1176619588 21:9046968-9046990 CCCTGTGACTGAATAGTGGCCAT No data
Right 1176619599 21:9047009-9047031 CAGCAGAGGAAGACCGGGGTAGG No data
1176619589_1176619599 17 Left 1176619589 21:9046969-9046991 CCTGTGACTGAATAGTGGCCATT No data
Right 1176619599 21:9047009-9047031 CAGCAGAGGAAGACCGGGGTAGG No data
1176619591_1176619599 -1 Left 1176619591 21:9046987-9047009 CCATTCCAGCTGCTCCAGGCTCC No data
Right 1176619599 21:9047009-9047031 CAGCAGAGGAAGACCGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176619599 Original CRISPR CAGCAGAGGAAGACCGGGGT AGG Intergenic
No off target data available for this crispr