ID: 1176623674

View in Genome Browser
Species Human (GRCh38)
Location 21:9074427-9074449
Sequence AGGCTGAATTCAACTCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176623674_1176623680 22 Left 1176623674 21:9074427-9074449 CCCTGGAGAGTTGAATTCAGCCT No data
Right 1176623680 21:9074472-9074494 ATGCCCAAATCTGCCCCACAGGG No data
1176623674_1176623684 28 Left 1176623674 21:9074427-9074449 CCCTGGAGAGTTGAATTCAGCCT No data
Right 1176623684 21:9074478-9074500 AAATCTGCCCCACAGGGCGGAGG 0: 4
1: 2
2: 0
3: 11
4: 151
1176623674_1176623682 25 Left 1176623674 21:9074427-9074449 CCCTGGAGAGTTGAATTCAGCCT No data
Right 1176623682 21:9074475-9074497 CCCAAATCTGCCCCACAGGGCGG 0: 4
1: 1
2: 2
3: 21
4: 204
1176623674_1176623679 21 Left 1176623674 21:9074427-9074449 CCCTGGAGAGTTGAATTCAGCCT No data
Right 1176623679 21:9074471-9074493 TATGCCCAAATCTGCCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176623674 Original CRISPR AGGCTGAATTCAACTCTCCA GGG (reversed) Intergenic
No off target data available for this crispr