ID: 1176626706

View in Genome Browser
Species Human (GRCh38)
Location 21:9097521-9097543
Sequence GGTCTGAATGACCCTCACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176626702_1176626706 9 Left 1176626702 21:9097489-9097511 CCTCACATAGGATTCCAGAACAC 0: 1290
1: 2642
2: 2731
3: 1806
4: 1073
Right 1176626706 21:9097521-9097543 GGTCTGAATGACCCTCACATAGG No data
1176626701_1176626706 10 Left 1176626701 21:9097488-9097510 CCCTCACATAGGATTCCAGAACA 0: 1414
1: 2685
2: 2809
3: 1751
4: 1058
Right 1176626706 21:9097521-9097543 GGTCTGAATGACCCTCACATAGG No data
1176626704_1176626706 -5 Left 1176626704 21:9097503-9097525 CCAGAACACTCCTGCTGTGGTCT 0: 206
1: 451
2: 786
3: 1375
4: 1788
Right 1176626706 21:9097521-9097543 GGTCTGAATGACCCTCACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176626706 Original CRISPR GGTCTGAATGACCCTCACAT AGG Intergenic
No off target data available for this crispr