ID: 1176649240

View in Genome Browser
Species Human (GRCh38)
Location 21:9530412-9530434
Sequence CAGTATAGCCCCAGATAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176649240_1176649243 -9 Left 1176649240 21:9530412-9530434 CCTGGCTATCTGGGGCTATACTG No data
Right 1176649243 21:9530426-9530448 GCTATACTGCCTGTGGTGGCAGG No data
1176649240_1176649247 -1 Left 1176649240 21:9530412-9530434 CCTGGCTATCTGGGGCTATACTG No data
Right 1176649247 21:9530434-9530456 GCCTGTGGTGGCAGGGGTGGTGG No data
1176649240_1176649244 -8 Left 1176649240 21:9530412-9530434 CCTGGCTATCTGGGGCTATACTG No data
Right 1176649244 21:9530427-9530449 CTATACTGCCTGTGGTGGCAGGG No data
1176649240_1176649249 0 Left 1176649240 21:9530412-9530434 CCTGGCTATCTGGGGCTATACTG No data
Right 1176649249 21:9530435-9530457 CCTGTGGTGGCAGGGGTGGTGGG No data
1176649240_1176649246 -4 Left 1176649240 21:9530412-9530434 CCTGGCTATCTGGGGCTATACTG No data
Right 1176649246 21:9530431-9530453 ACTGCCTGTGGTGGCAGGGGTGG No data
1176649240_1176649245 -7 Left 1176649240 21:9530412-9530434 CCTGGCTATCTGGGGCTATACTG No data
Right 1176649245 21:9530428-9530450 TATACTGCCTGTGGTGGCAGGGG No data
1176649240_1176649250 1 Left 1176649240 21:9530412-9530434 CCTGGCTATCTGGGGCTATACTG No data
Right 1176649250 21:9530436-9530458 CTGTGGTGGCAGGGGTGGTGGGG No data
1176649240_1176649252 3 Left 1176649240 21:9530412-9530434 CCTGGCTATCTGGGGCTATACTG No data
Right 1176649252 21:9530438-9530460 GTGGTGGCAGGGGTGGTGGGGGG No data
1176649240_1176649253 6 Left 1176649240 21:9530412-9530434 CCTGGCTATCTGGGGCTATACTG No data
Right 1176649253 21:9530441-9530463 GTGGCAGGGGTGGTGGGGGGAGG No data
1176649240_1176649251 2 Left 1176649240 21:9530412-9530434 CCTGGCTATCTGGGGCTATACTG No data
Right 1176649251 21:9530437-9530459 TGTGGTGGCAGGGGTGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176649240 Original CRISPR CAGTATAGCCCCAGATAGCC AGG (reversed) Intergenic
No off target data available for this crispr