ID: 1176649280

View in Genome Browser
Species Human (GRCh38)
Location 21:9530573-9530595
Sequence CTACAATGCTGGCGGGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176649267_1176649280 15 Left 1176649267 21:9530535-9530557 CCCGCAGCAGGGAGTGGGTTGAG No data
Right 1176649280 21:9530573-9530595 CTACAATGCTGGCGGGGGGGTGG No data
1176649268_1176649280 14 Left 1176649268 21:9530536-9530558 CCGCAGCAGGGAGTGGGTTGAGT No data
Right 1176649280 21:9530573-9530595 CTACAATGCTGGCGGGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176649280 Original CRISPR CTACAATGCTGGCGGGGGGG TGG Intergenic
No off target data available for this crispr