ID: 1176653463

View in Genome Browser
Species Human (GRCh38)
Location 21:9570408-9570430
Sequence CAGAGCAGACAGAAGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176653463_1176653472 28 Left 1176653463 21:9570408-9570430 CCTCCTGCCTTCTGTCTGCTCTG No data
Right 1176653472 21:9570459-9570481 CAAGTCACCGGGCTGAGCCTGGG No data
1176653463_1176653470 17 Left 1176653463 21:9570408-9570430 CCTCCTGCCTTCTGTCTGCTCTG No data
Right 1176653470 21:9570448-9570470 ATCAGGAAGCTCAAGTCACCGGG No data
1176653463_1176653469 16 Left 1176653463 21:9570408-9570430 CCTCCTGCCTTCTGTCTGCTCTG No data
Right 1176653469 21:9570447-9570469 CATCAGGAAGCTCAAGTCACCGG No data
1176653463_1176653471 27 Left 1176653463 21:9570408-9570430 CCTCCTGCCTTCTGTCTGCTCTG No data
Right 1176653471 21:9570458-9570480 TCAAGTCACCGGGCTGAGCCTGG No data
1176653463_1176653466 0 Left 1176653463 21:9570408-9570430 CCTCCTGCCTTCTGTCTGCTCTG No data
Right 1176653466 21:9570431-9570453 CATCCTTCACCTTCTACATCAGG 0: 6
1: 1
2: 3
3: 24
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176653463 Original CRISPR CAGAGCAGACAGAAGGCAGG AGG (reversed) Intergenic
No off target data available for this crispr