ID: 1176654021

View in Genome Browser
Species Human (GRCh38)
Location 21:9573921-9573943
Sequence CAGGCTGCACACCTGGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176654021_1176654029 18 Left 1176654021 21:9573921-9573943 CCTGTGCCCAGGTGTGCAGCCTG No data
Right 1176654029 21:9573962-9573984 ATAGAGCCTAGGTGTACAGTAGG No data
1176654021_1176654027 7 Left 1176654021 21:9573921-9573943 CCTGTGCCCAGGTGTGCAGCCTG No data
Right 1176654027 21:9573951-9573973 TAGGCTGTGCCATAGAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176654021 Original CRISPR CAGGCTGCACACCTGGGCAC AGG (reversed) Intergenic
No off target data available for this crispr