ID: 1176654406

View in Genome Browser
Species Human (GRCh38)
Location 21:9576721-9576743
Sequence CTGGACTCCAGGTGTACATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176654399_1176654406 6 Left 1176654399 21:9576692-9576714 CCTGGTATGTATTAGTAACCAAG No data
Right 1176654406 21:9576721-9576743 CTGGACTCCAGGTGTACATCAGG No data
1176654398_1176654406 13 Left 1176654398 21:9576685-9576707 CCATTTTCCTGGTATGTATTAGT No data
Right 1176654406 21:9576721-9576743 CTGGACTCCAGGTGTACATCAGG No data
1176654395_1176654406 25 Left 1176654395 21:9576673-9576695 CCCAGGTATATACCATTTTCCTG 0: 7
1: 0
2: 6
3: 348
4: 9012
Right 1176654406 21:9576721-9576743 CTGGACTCCAGGTGTACATCAGG No data
1176654394_1176654406 26 Left 1176654394 21:9576672-9576694 CCCCAGGTATATACCATTTTCCT 0: 7
1: 0
2: 1
3: 38
4: 424
Right 1176654406 21:9576721-9576743 CTGGACTCCAGGTGTACATCAGG No data
1176654396_1176654406 24 Left 1176654396 21:9576674-9576696 CCAGGTATATACCATTTTCCTGG 0: 7
1: 0
2: 0
3: 31
4: 1096
Right 1176654406 21:9576721-9576743 CTGGACTCCAGGTGTACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176654406 Original CRISPR CTGGACTCCAGGTGTACATC AGG Intergenic
No off target data available for this crispr