ID: 1176660779

View in Genome Browser
Species Human (GRCh38)
Location 21:9633616-9633638
Sequence CCCTCTATGCTGGATCTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176660776_1176660779 -6 Left 1176660776 21:9633599-9633621 CCTGTGCTGAGGCAGCTCCCTCT No data
Right 1176660779 21:9633616-9633638 CCCTCTATGCTGGATCTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176660779 Original CRISPR CCCTCTATGCTGGATCTGCG AGG Intergenic
No off target data available for this crispr