ID: 1176661992

View in Genome Browser
Species Human (GRCh38)
Location 21:9645699-9645721
Sequence CTCAAAAATTAGTTGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176661992_1176661996 -6 Left 1176661992 21:9645699-9645721 CCATGGCCCAACTAATTTTTGAG No data
Right 1176661996 21:9645716-9645738 TTTGAGTTTTTACTAGAGATGGG No data
1176661992_1176661999 18 Left 1176661992 21:9645699-9645721 CCATGGCCCAACTAATTTTTGAG No data
Right 1176661999 21:9645740-9645762 TTTCACCATGTTACCCAGGATGG 0: 137
1: 21813
2: 87737
3: 177620
4: 203883
1176661992_1176661995 -7 Left 1176661992 21:9645699-9645721 CCATGGCCCAACTAATTTTTGAG No data
Right 1176661995 21:9645715-9645737 TTTTGAGTTTTTACTAGAGATGG No data
1176661992_1176661998 14 Left 1176661992 21:9645699-9645721 CCATGGCCCAACTAATTTTTGAG No data
Right 1176661998 21:9645736-9645758 GGGGTTTCACCATGTTACCCAGG 0: 311
1: 24316
2: 137746
3: 206235
4: 199521
1176661992_1176661997 -5 Left 1176661992 21:9645699-9645721 CCATGGCCCAACTAATTTTTGAG No data
Right 1176661997 21:9645717-9645739 TTGAGTTTTTACTAGAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176661992 Original CRISPR CTCAAAAATTAGTTGGGCCA TGG (reversed) Intergenic
No off target data available for this crispr