ID: 1176663477

View in Genome Browser
Species Human (GRCh38)
Location 21:9662188-9662210
Sequence CGGTGCTGCAGCTGAGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176663469_1176663477 22 Left 1176663469 21:9662143-9662165 CCAATCACTGAGATGGTGAGTGT No data
Right 1176663477 21:9662188-9662210 CGGTGCTGCAGCTGAGGAGATGG No data
1176663473_1176663477 -3 Left 1176663473 21:9662168-9662190 CCGGGGAAGAAGCTTTCATCCGG No data
Right 1176663477 21:9662188-9662210 CGGTGCTGCAGCTGAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176663477 Original CRISPR CGGTGCTGCAGCTGAGGAGA TGG Intergenic
No off target data available for this crispr