ID: 1176663477 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:9662188-9662210 |
Sequence | CGGTGCTGCAGCTGAGGAGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1176663469_1176663477 | 22 | Left | 1176663469 | 21:9662143-9662165 | CCAATCACTGAGATGGTGAGTGT | No data | ||
Right | 1176663477 | 21:9662188-9662210 | CGGTGCTGCAGCTGAGGAGATGG | No data | ||||
1176663473_1176663477 | -3 | Left | 1176663473 | 21:9662168-9662190 | CCGGGGAAGAAGCTTTCATCCGG | No data | ||
Right | 1176663477 | 21:9662188-9662210 | CGGTGCTGCAGCTGAGGAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1176663477 | Original CRISPR | CGGTGCTGCAGCTGAGGAGA TGG | Intergenic | ||
No off target data available for this crispr |