ID: 1176665085

View in Genome Browser
Species Human (GRCh38)
Location 21:9678965-9678987
Sequence AGCCGGCTGGGTTTCTGTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176665085_1176665090 13 Left 1176665085 21:9678965-9678987 CCGACACAGAAACCCAGCCGGCT No data
Right 1176665090 21:9679001-9679023 GCACTTGCCCTGAGACTTTGCGG No data
1176665085_1176665093 25 Left 1176665085 21:9678965-9678987 CCGACACAGAAACCCAGCCGGCT No data
Right 1176665093 21:9679013-9679035 AGACTTTGCGGCACCTAGCCTGG No data
1176665085_1176665094 26 Left 1176665085 21:9678965-9678987 CCGACACAGAAACCCAGCCGGCT No data
Right 1176665094 21:9679014-9679036 GACTTTGCGGCACCTAGCCTGGG No data
1176665085_1176665088 -9 Left 1176665085 21:9678965-9678987 CCGACACAGAAACCCAGCCGGCT No data
Right 1176665088 21:9678979-9679001 CAGCCGGCTTCAGCTCTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176665085 Original CRISPR AGCCGGCTGGGTTTCTGTGT CGG (reversed) Intergenic
No off target data available for this crispr