ID: 1176667120

View in Genome Browser
Species Human (GRCh38)
Location 21:9697967-9697989
Sequence GCTGAACCCCAGGCAGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176667120_1176667130 30 Left 1176667120 21:9697967-9697989 CCGGCTTCTGCCTGGGGTTCAGC No data
Right 1176667130 21:9698020-9698042 TCTGTCTTTGGAGTTGGTGCTGG No data
1176667120_1176667128 24 Left 1176667120 21:9697967-9697989 CCGGCTTCTGCCTGGGGTTCAGC No data
Right 1176667128 21:9698014-9698036 AGAACCTCTGTCTTTGGAGTTGG No data
1176667120_1176667127 18 Left 1176667120 21:9697967-9697989 CCGGCTTCTGCCTGGGGTTCAGC No data
Right 1176667127 21:9698008-9698030 TGCAGCAGAACCTCTGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176667120 Original CRISPR GCTGAACCCCAGGCAGAAGC CGG (reversed) Intergenic
No off target data available for this crispr