ID: 1176668279

View in Genome Browser
Species Human (GRCh38)
Location 21:9707674-9707696
Sequence TTCTGTGCATGGAGGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176668274_1176668279 20 Left 1176668274 21:9707631-9707653 CCACTGTTGTTGTTTCCATTCAT No data
Right 1176668279 21:9707674-9707696 TTCTGTGCATGGAGGGAAAAAGG No data
1176668275_1176668279 5 Left 1176668275 21:9707646-9707668 CCATTCATGCTTATTCTTTATGA No data
Right 1176668279 21:9707674-9707696 TTCTGTGCATGGAGGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176668279 Original CRISPR TTCTGTGCATGGAGGGAAAA AGG Intergenic
No off target data available for this crispr