ID: 1176668484

View in Genome Browser
Species Human (GRCh38)
Location 21:9709608-9709630
Sequence ATCAAGACGCAGAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176668476_1176668484 14 Left 1176668476 21:9709571-9709593 CCTCTGGAGGACTGAGGTCTCCA No data
Right 1176668484 21:9709608-9709630 ATCAAGACGCAGAGGAAGGAAGG No data
1176668479_1176668484 -6 Left 1176668479 21:9709591-9709613 CCACCACCTTGGAGGAAATCAAG No data
Right 1176668484 21:9709608-9709630 ATCAAGACGCAGAGGAAGGAAGG No data
1176668480_1176668484 -9 Left 1176668480 21:9709594-9709616 CCACCTTGGAGGAAATCAAGACG No data
Right 1176668484 21:9709608-9709630 ATCAAGACGCAGAGGAAGGAAGG No data
1176668474_1176668484 22 Left 1176668474 21:9709563-9709585 CCAGGTGTCCTCTGGAGGACTGA No data
Right 1176668484 21:9709608-9709630 ATCAAGACGCAGAGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176668484 Original CRISPR ATCAAGACGCAGAGGAAGGA AGG Intergenic
No off target data available for this crispr