ID: 1176677731

View in Genome Browser
Species Human (GRCh38)
Location 21:9795486-9795508
Sequence CTGTGTCCGTATCAAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176677724_1176677731 28 Left 1176677724 21:9795435-9795457 CCAAATCAGAGGTAATTCTGATT No data
Right 1176677731 21:9795486-9795508 CTGTGTCCGTATCAAATGGAGGG No data
1176677727_1176677731 -6 Left 1176677727 21:9795469-9795491 CCTGTTAATGGATAAACCTGTGT No data
Right 1176677731 21:9795486-9795508 CTGTGTCCGTATCAAATGGAGGG No data
1176677723_1176677731 29 Left 1176677723 21:9795434-9795456 CCCAAATCAGAGGTAATTCTGAT No data
Right 1176677731 21:9795486-9795508 CTGTGTCCGTATCAAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176677731 Original CRISPR CTGTGTCCGTATCAAATGGA GGG Intergenic
No off target data available for this crispr