ID: 1176680823

View in Genome Browser
Species Human (GRCh38)
Location 21:9818405-9818427
Sequence GAGCATCGCGGCGCGCGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176680823_1176680826 -8 Left 1176680823 21:9818405-9818427 CCGCCGCGCGCGCCGCGATGCTC No data
Right 1176680826 21:9818420-9818442 CGATGCTCCTGCTGCCGTCCCGG No data
1176680823_1176680835 25 Left 1176680823 21:9818405-9818427 CCGCCGCGCGCGCCGCGATGCTC No data
Right 1176680835 21:9818453-9818475 GTCTTGGGTCCTGTTTCAGGCGG No data
1176680823_1176680829 9 Left 1176680823 21:9818405-9818427 CCGCCGCGCGCGCCGCGATGCTC No data
Right 1176680829 21:9818437-9818459 TCCCGGCAGCGCCTGTGTCTTGG No data
1176680823_1176680836 30 Left 1176680823 21:9818405-9818427 CCGCCGCGCGCGCCGCGATGCTC No data
Right 1176680836 21:9818458-9818480 GGGTCCTGTTTCAGGCGGCGTGG No data
1176680823_1176680834 22 Left 1176680823 21:9818405-9818427 CCGCCGCGCGCGCCGCGATGCTC No data
Right 1176680834 21:9818450-9818472 TGTGTCTTGGGTCCTGTTTCAGG No data
1176680823_1176680831 10 Left 1176680823 21:9818405-9818427 CCGCCGCGCGCGCCGCGATGCTC No data
Right 1176680831 21:9818438-9818460 CCCGGCAGCGCCTGTGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176680823 Original CRISPR GAGCATCGCGGCGCGCGCGG CGG (reversed) Intergenic
No off target data available for this crispr