ID: 1176691264

View in Genome Browser
Species Human (GRCh38)
Location 21:9913151-9913173
Sequence CTTTATCACTTTAACGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176691262_1176691264 20 Left 1176691262 21:9913108-9913130 CCCAACACTGGTAATGAGCTTGT No data
Right 1176691264 21:9913151-9913173 CTTTATCACTTTAACGCAGATGG No data
1176691263_1176691264 19 Left 1176691263 21:9913109-9913131 CCAACACTGGTAATGAGCTTGTA No data
Right 1176691264 21:9913151-9913173 CTTTATCACTTTAACGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176691264 Original CRISPR CTTTATCACTTTAACGCAGA TGG Intergenic
No off target data available for this crispr