ID: 1176696832

View in Genome Browser
Species Human (GRCh38)
Location 21:9988227-9988249
Sequence TCTTATGTAAGATTAACTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176696828_1176696832 10 Left 1176696828 21:9988194-9988216 CCATTTTTCTTTTGTTAGCCATT No data
Right 1176696832 21:9988227-9988249 TCTTATGTAAGATTAACTTATGG No data
1176696829_1176696832 -8 Left 1176696829 21:9988212-9988234 CCATTGCCTTCTTCCTCTTATGT No data
Right 1176696832 21:9988227-9988249 TCTTATGTAAGATTAACTTATGG No data
1176696826_1176696832 20 Left 1176696826 21:9988184-9988206 CCAAACAAGCCCATTTTTCTTTT No data
Right 1176696832 21:9988227-9988249 TCTTATGTAAGATTAACTTATGG No data
1176696827_1176696832 11 Left 1176696827 21:9988193-9988215 CCCATTTTTCTTTTGTTAGCCAT No data
Right 1176696832 21:9988227-9988249 TCTTATGTAAGATTAACTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176696832 Original CRISPR TCTTATGTAAGATTAACTTA TGG Intergenic
No off target data available for this crispr