ID: 1176700080

View in Genome Browser
Species Human (GRCh38)
Location 21:10036053-10036075
Sequence TCTTTTTTAATTTATGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176700080_1176700084 15 Left 1176700080 21:10036053-10036075 CCATCTTCATAAATTAAAAAAGA No data
Right 1176700084 21:10036091-10036113 GAAGTGGAATGAGGAAGGTGTGG No data
1176700080_1176700085 16 Left 1176700080 21:10036053-10036075 CCATCTTCATAAATTAAAAAAGA No data
Right 1176700085 21:10036092-10036114 AAGTGGAATGAGGAAGGTGTGGG No data
1176700080_1176700081 -1 Left 1176700080 21:10036053-10036075 CCATCTTCATAAATTAAAAAAGA No data
Right 1176700081 21:10036075-10036097 AAACATAATAACTAGCGAAGTGG No data
1176700080_1176700082 6 Left 1176700080 21:10036053-10036075 CCATCTTCATAAATTAAAAAAGA No data
Right 1176700082 21:10036082-10036104 ATAACTAGCGAAGTGGAATGAGG No data
1176700080_1176700083 10 Left 1176700080 21:10036053-10036075 CCATCTTCATAAATTAAAAAAGA No data
Right 1176700083 21:10036086-10036108 CTAGCGAAGTGGAATGAGGAAGG No data
1176700080_1176700086 17 Left 1176700080 21:10036053-10036075 CCATCTTCATAAATTAAAAAAGA No data
Right 1176700086 21:10036093-10036115 AGTGGAATGAGGAAGGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176700080 Original CRISPR TCTTTTTTAATTTATGAAGA TGG (reversed) Intergenic
No off target data available for this crispr