ID: 1176700083

View in Genome Browser
Species Human (GRCh38)
Location 21:10036086-10036108
Sequence CTAGCGAAGTGGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176700080_1176700083 10 Left 1176700080 21:10036053-10036075 CCATCTTCATAAATTAAAAAAGA No data
Right 1176700083 21:10036086-10036108 CTAGCGAAGTGGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176700083 Original CRISPR CTAGCGAAGTGGAATGAGGA AGG Intergenic
No off target data available for this crispr