ID: 1176700341

View in Genome Browser
Species Human (GRCh38)
Location 21:10040332-10040354
Sequence CTGTTGTTGTTAAGAAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176700341_1176700344 26 Left 1176700341 21:10040332-10040354 CCTTATTTTCTTAACAACAACAG No data
Right 1176700344 21:10040381-10040403 TGCCGCATGCACCTAGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176700341 Original CRISPR CTGTTGTTGTTAAGAAAATA AGG (reversed) Intergenic
No off target data available for this crispr