ID: 1176704360

View in Genome Browser
Species Human (GRCh38)
Location 21:10100995-10101017
Sequence CAGGCACATGGTGTTGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176704352_1176704360 24 Left 1176704352 21:10100948-10100970 CCTTCTGGCTGCTTTTGTGGGCT No data
Right 1176704360 21:10100995-10101017 CAGGCACATGGTGTTGTTGGTGG No data
1176704349_1176704360 28 Left 1176704349 21:10100944-10100966 CCTGCCTTCTGGCTGCTTTTGTG No data
Right 1176704360 21:10100995-10101017 CAGGCACATGGTGTTGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176704360 Original CRISPR CAGGCACATGGTGTTGTTGG TGG Intergenic
No off target data available for this crispr