ID: 1176706062

View in Genome Browser
Species Human (GRCh38)
Location 21:10120587-10120609
Sequence GAGTTGAATTTGAAGTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176706057_1176706062 0 Left 1176706057 21:10120564-10120586 CCCAACTCGGACAGAAGGCCCAT No data
Right 1176706062 21:10120587-10120609 GAGTTGAATTTGAAGTTTGTGGG No data
1176706053_1176706062 13 Left 1176706053 21:10120551-10120573 CCACTAGGGGTACCCCAACTCGG No data
Right 1176706062 21:10120587-10120609 GAGTTGAATTTGAAGTTTGTGGG No data
1176706049_1176706062 30 Left 1176706049 21:10120534-10120556 CCAGGGTTCGCGTCGGGCCACTA No data
Right 1176706062 21:10120587-10120609 GAGTTGAATTTGAAGTTTGTGGG No data
1176706056_1176706062 1 Left 1176706056 21:10120563-10120585 CCCCAACTCGGACAGAAGGCCCA No data
Right 1176706062 21:10120587-10120609 GAGTTGAATTTGAAGTTTGTGGG No data
1176706058_1176706062 -1 Left 1176706058 21:10120565-10120587 CCAACTCGGACAGAAGGCCCATG No data
Right 1176706062 21:10120587-10120609 GAGTTGAATTTGAAGTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176706062 Original CRISPR GAGTTGAATTTGAAGTTTGT GGG Intergenic
No off target data available for this crispr